Korean J Leg Med Search

CLOSE


Korean J Leg Med > Volume 45(1); 2021 > Article
실시간 PCR System을 이용한 법미생물학적 질액 식별

Abstract

Numerous methods for human body fluid identification using microbiological markers specific to different human body parts are well-established in forensic science. However, method for vaginal fluid screening have not been standardized yet. Therefore, in this study, a real-time polymerase chain reaction based assay for vaginal fluid identification was devised using bacteria residing in human vagina. This method employed three markers, namely Lactobacillus iners, Lactobacillus crispatus, and Bacteroides fragilis. L. iners and L. crispatus were chosen due to their high abundance in the vagina, whereas B. fragilis resides in the rectum. To examine the suitability of the new method for forensic microbial applications, a study of the distribution of vaginal flora in 143 Korean women was performed, along with characterization of the specificity, and performance of the new assay. Additionally, a casework study based on 130, 21, 20 and 17 DNA samples collected from the vagina, anus, saliva, blood, respectively, was carried out. L. iners (80.4%) and L. crispatus (55.2%) were detected with high abundance in the vagina of Korean women. The specificity of these markers was verified using microbial DNA from 23 species. This method could detect at least 1,000 copies/µL of microorganisms for all markers, thereby highlighting its robust sensitivity for vaginal fluid identification. The casework study confirmed these findings, with 89.2% (116/130) detection of vaginal fluid-derived DNA samples, and no false positives identified from the other sources studied. In conclusion, the developed method is expected to be efficient for preliminary microbiological analysis of vaginal samples in forensics.

서론

미생물은 인간의 신체 부위에 따라 특이적으로 상재하기 때문에[1], 미생물 동정을 통해 다양한 연구 분야에서 활용되고 있다. 최근에는 다른 기법에 비해 시험 속도가 빠르고, 낮은 농도의 미생물을 식별할 수 있으며, 특정 미생물을 식별할 수 있는 특이도가 높은 분자생물학적 동정 기법이 다양한 분야에서 쓰이고 있다. 법미생물학 분야에서도 미생물의 특성과 분자생물학적 동정 기법을 활용하여 범죄 사건의 진위 확인 과정에서 증거를 분석하는 데 효과적으로 활용되고 있다[2].
생체 증거물의 법과학적 분석은 생체 증거물의 근원을 밝히는 실험과 그 생체 증거물이 누구의 것인지를 밝히는 두 가지 단계로 구성된다. 성추행과 같이 피해자의 신체가 아닌 곳에서 피해자의 DNA형이 검출될 경우, 생체 증거물로부터 유래된 DNA의 근원을 밝히는 것은 사건 진위 여부의 판단에 있어 매우 중요한 과정이다. 생체 증거물의 근원을 밝히는 실험은 주로 면역학적 또는 생화학적 반응을 이용한 발색 반응을 사용해왔으나[3], 최근에는 mRNA 검출, DNA 메틸화 기법 및 미생물 동정 등 다양한 유전자 검출법들이 연구되고 있다[4-6]. 그러나 RNA는 상존하는 universal ribonuclease 때문에 상태가 불안정하고, DNA 메틸화 기법은 bisulfite 변환 과정이 필요하기 때문에 시간과 비용이 많이 필요하다[7,8]. 반면 실시간 polymerase chain reaction (PCR) 기법을 이용한 미생물 동정은 시료의 전처리 과정과 이를 위한 별도의 실험과정이 없이 높은 민감도와 특이도를 제공하는 장점을 가지고 있다[7,9]. 이와 같은 기법을 활용하여 생체 증거물의 타액 식별을 위한 구강 미생물 검출 키트가 사용되고 있다[7]. 하지만 질 분비물을 확인하기 위한 분자생물학적 동정 기법은 아직 상용화 되지 않았다. 전통적으로 질 분비물을 구별하는 방법으로 글리코겐화 된 상피세포를 확인하는 실험기법이 활용되었으나 특이도가 낮아 정확한 실험이 불가능하다는 단점이 있다[10,11]. 이와 같은 단점을 개선하고자 여성 질 내에 존재하는 정상 상재균의 확인을 통해 질 분비물을 식별하고자 하였다.
본 연구에서는 질 내 상재균을 마커로 선정하고 실시간 다중 PCR 키트 기법에 기반하여 질 분비물 식별 키트를 제작하였다. 모든 여성의 질 내에서 동일한 비율로 미생물군집이 구성되지 않기 때문에, 한국인 여성에서 가장 높은 비율로 분포하는 Lactobacillus species (spp.) 중 L. inersL. crispatus를 마커로 선정하였다[12-15]. 또한, Lactobacillus spp.는 대변과 직장에서도 상재하는 미생물이기 때문에[16], 대변 및 위장관 유래의 체액과 질 유래 체액의 분별을 위해 직장 내 상재균인 Bacteroides fragilis를 표적미생물로 선정하여 질액 식별 시스템인 Vaginal Bacteria Multiplex Real-time PCR (VB mRT-PCR) 키트를 구성하였다[17,18]. 해당키트의 활용 가능성을 확인하기 위해 각 마커에 대한 특이도 및 민감도 실험을 진행하였다. 동시에, 여러 범죄 사건에서 수집된 생존자들의 다양한 인체 유래물들을 이용하여 일관된 결과를 제공할 수 있는지 확인하였다. 이러한 결과를 토대로, 새롭게 제작된 VB mRT-PCR 키트의 효용성을 검토하고 법미생물학적 활용 가능성을 제시하고자 한다.

재료및 방법

1. 미생물 시료

VB mRT-PCR 키트의 특이성을 확인하기 위해 여성의 질 상재균으로 알려진 L. crispatus, L. inersLactobacillus jensenii와 장내 상재균으로 알려진 B. fragilis를 실험에 사용하였다. 본 연구에서 사용된 L. crispatus (KACC 12439)와 L. jensenii (KACC 12437)는 국립농업과학원 미생물은행(Korean Agricultural Culture Collection [KACC], Wanju, Korea)으로부터 분양 받았으며, L. iners (ATCC 55195)는 American Type Culture Collection (ATCC, Manassas, VA, USA)으로부터 구매하였다. B. fragilis (ATCC 25285)는 연세대학교 보건과학대학 임상병리학과 임상미생물연구실로부터 구매하였다. 각 미생물의 배양은 ATCC에서 제안한 환경에 따라 진행되었다. L. inersB. fragilis는 ATCC Medium 260: trypticase soy broth (cat. 211825, Becton Dickinson, East Rutherford, NJ, USA) 배지를 사용했으며, L. crispatusL. jensenii는 ATCC Medium 416: Lactobacilli MRS broth (cat. 288130, Becton Dickinson)를 사용하여 배양 및 증식시켜 −196℃ 액화질소 탱크에 냉동 보관했으며, DNA는 PrepMan Ultra Sample Preparation Reagent (Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 제조사 매뉴얼에 따라 추출하였다(Thermo Fisher Scientific, 2018). 또한 표준 곡선 확인, 민감도 연구, 특이도 연구에 사용된 DNA 시료들은 국가병원체자원은행(National Culture Collection for Pathogens, Cheongju, Korea) 및 한국생명공학연구원 생물자원센터(Korean Collection for Type Cultures, Jeongeup, Korea)에서 제공받았다. 특이도 연구에서 사용된 23개의 세균 genomic DNA 시료들은 농도가 모두 0.224 ng/μL 이상의 DNA 시료들이 사용되었다(Table 1).
Table 1.
Bacterial species used for specificity study of the VB mRT-PCR
Species Strain Species Strain
Lactobacillus iners ATCC 55195 Proteus mirabilis KCTC 2510
Lactobacillus crispatus KACC 12439 Shigella boydii NCCP 14745
Lactobacillus jensenii KACC 12437 Esherichia coli O157 NCCP 14541
Bacteroides fragilis ATCC 25285 Vibrio vulinificus NCCP 11135
Esherichia coli EPEC NCCP 14038 Salmonella enteritidis NCCP 12243
Bacillus cereus NCCP 14796 Clostridium perfringens NCCP 10347
Listeria monocytogenes NCCP 10943 Lactobacillus gasseri KCTC 3173
Salmonella
Paratyphi A
NCCP 14759 Campylobacter jejuni NCCP 11192
Staphylococcus aureus NCCP 14780 Staphylococcus epidermidis NCCP 14690
Shigella dysentriae NCCP 14746 Salmonella Typhi NCCP 10932
Atpobium vaginalis KCTC 15240 Shigella sonnei NCCP 14743
Campylobacter coli NCCP 11191    

VB mRT-PCR, Vaginal Bacteria Multiplex Real-time PCR.

2. 한국인 143명 시료 및 사건 현장 시료

한국 여성 질 내 미생물 분포를 확인하기 위해 143명의 한국인 여성 질액 시료 샘플들을 지원자들로부터 수집하였다. 지원자들은 17-68세의 여성들로, 다양한 연령대의 여성의 질액 시료들이 수집되었다. 또한 법과학적 활용 연구에 사용된 130개의 질 분비물 시료, 21개의 항문 시료, 20개의 타액 시료, 그리고 17개의 말초 혈액 시료는 사건 유래 증거물로써 성범죄 사건과 연관된 여성 피해자로부터 채취된 시료들을 사용하였으며, 시신에서 채취된 시료들은 모두 배제되었다. 해당 시료들은 수사가 종결된 사건의 선별된 시료 잔량들만 사용되었다. 해당 인체 유래 시료들은 QIAamp Micro kit (Qiagen, Hilden, Germany)를 이용하여 제조사 매뉴얼에 따라 DNA를 추출하였다[19]. 추출된 DNA 시료들은 Quantifiler Trio DNA quantification kit (Thermo Fisher Scientific)를 제조사의 메뉴얼[20]에 따라 이용하여, 여성 DNA 유무를 확인함으로써 질액 시료가 적절하게 채취되었는지 확인하였다. 해당 연구는 사전 연구 동의를 받아 진행되었으며, 국립과학수사연구원 생명윤리위원회(Institutional Review Board)로부터 승인되었다(IRB number: 906-190124-BR-002-02).

3. 프라이머 및 프로브 설계

마커로 선정된 L. crispatus, L. iners, L. jenseniiB. fragilis는 종 간 염기서열에 차이를 나타내며, 종 내에서는 변이가 적은 groEL 유전자 부위를 표적으로 미생물 종 식별을 위한 프라이머와 프로브를 설계하였다. Internal positive control (IPC) 마커는 white spot syndrome virus의 VP28 유전자 부위를 표적으로 프라이머와 프로브가 설계되었다.
선정된 4개의 미생물의 각각 특이적인 유전자 부위의 선별을 위해 Mega × (64-bit) 상동성 분석 소프트웨어(https://www.megasoftware.net/)를 이용하여 수행하였다. 유전자 상동성 분석 결과를 바탕으로, L. crispatus, L. iners, L. jenseniiB. fragillis를 동시에 검출하는 프라이머 및 프로브를 설계하였다. Table 2에 기재된 프라이머들과 프로브들의 각각의 서열은 동일한 온도 조건에서 실험이 가능하도록 유사한 melting temperature (Tm) 값을 유지할 수 있도록 설계되었고, hairpin 구조나 dimer 구조 등 PCR 증폭을 저해하는 구조 형성 여부를 확인하여 설계하였다. 프라이머와 프로브의 길이, GC%, Tm 값의 분석은 Integrated DNA Technologies (IDT, Coralville, IW, USA)에서 제공하는 웹 기반 프로그램인 OligoAnalyzer 프로그램 (https://sg.idtdna.com/calc/analyzer)을 이용하여 수행하였다. OligoAnalyzer 프로그램에서 제시하는 기본 조건에 따라 oligomer 농도 0.25 μM 및 Na+ 농도 50 mM에서 분석을 진행하였다.
Table 2.
Sequence for primers and probes on bacterial markers in this study
Marker Primer/Probe Sequence (5′ → 3′) Length (bp) Reporter dye Quencher dye PCR product (bp)
Lactobacillus crispatus Forward TAATGAATTGCACAAGATTAGC 22 FAM BHQ1 89
  Reverse CAACTTCCTTTGAAGATGAT 20      
  Probe FAM-AGGTTGAATCAAGAGACCAAA 21      
L. iners Forward AGCAGAATTGCATAAAATTAGT 22 TAMRA BHQ1 89
  Reverse CAACTTCTGTTGATGCTGAA 20      
  Probe ATGAAGTAAGTTCTAAAGCTGAAA 24      
L. jensenii Forward TGATGAATTGCATAAGATTAGC 22 JOE BHQ1 89
  Reverse CTACTTCTTCTGAAGCACTT 20      
  Probe AGGTTTCTGGCCGTGACGAAA 21      
B. fragilis Forward AGAAATATTATTCAATATCGAAGCT 25 JOE BHQ1 87
  Reverse GGGCCYAGTGTTACTTTT 18      
  Probe AGGTGTTGATGCTTTGGC 18      
Internal positive control (IPC) Forward GACAATATCGAGACAAACATGGA 23 CY5 BHQ2 77
  Reverse ATCTTGAAGTAGCCTGATCCAAC 23      
  Probe CCTCCGCATTCCTGTGACTGC 21      

4. VB RT-PCR 키트의 실시간 PCR 증폭

VB RT-PCR 키트는 FAM-NOVA, TAMRA, JOE, CY5와 ROX와 같은 효과적으로 다중증폭이 가능한 형광 염료 세트와 BHQ1와 BHQ2가 quencher로 사용되어, SFC (Cheongwon, Korea)에 의뢰해 다중 TaqMan 형광 프로브를 합성하여, 실시간 증폭 기법을 활용하여 분석 가능하도록 설계되었다. 해당 연구를 진행하기 위해 2가지 키트의 형태로 실험이 진행되었다. 첫 번째 키트는 한국 여성을 대상으로 질 내 상재균의 분포 비율 및 각 마커의 특이도 확인을 위해 L. iners, L. jensenii, L. crispatus와 IPC가 마커로 포함되어 제작되었다. 두 번째 키트는 질 내 상재균 3종 중 분포 비율이 낮았던 L. jensenii를 제외하고 L. iners, L. crispatus 마커와 직장 내 상재균인 B. fragilis 마커 및 IPC로 구성되었으며, 특이도, 민감도, 사건 시료 연구들을 진행하였다. 이 기법은 한 반응당 증류수 7 μL, 2× hot-start real-time PCR master mix (AttoPlex Corporation, Namyangju, Korea) 10 μL, primer mix (each 20 μM, 20×) 1 μL와 DNA sample 2 μL로, 총 볼륨이 20 μL로 구성되었다. 각 PCR 반응은 Micro Amp Optical 96-well reaction plates와 Micro Amp optical adhesive film (Thermo Fisher Scientific)을 사용하여 수행되었다. PCR 증폭은 7500 Real-time PCR System (Thermo Fisher Scientific)을 통해 수행되었으며, 다음의 PCR 조성에 따라 진행되었다(1단계: 95℃ 5분, 2단계: 95℃ 10초, 55℃ 1분을 한 cycle로 40 cycle). 증폭된 시료들은 HID Real-Time PCR Software v1.2 (Thermo Fisher Scientific)를 사용하여 분석되었다. 모든 마커들의 threshold는 0.25로 설정해 threshold cycle (CT)를 분석하였다.

5. 민감도 연구

VB mRT-PCR 키트의 성능 검증을 위해 배양했던 2종의 질 내 상재균과 1종의 장내 상재균의 DNA를 시료를, 10-107 copies/μL의 농도로 10배씩 희석시켜 민감도 실험을진행하였다. 각 농도 별 시료들은 3회 반복 실험하여 평균 threshold cycle (C T)와 표준편차를 측정하였다.

결과

1. 질 분비물 검사를 위한 표적 미생물 선정 및 종 특이성 연구

VB mRT-PCR 키트에 사용될 마커를 선별하기 위해, 한국 여성의 질 내에서 가장 높은 분포의 정상 상재균 3종(L. iners, L. crispatusL. jensenii)과 직장 내 상재균 1종 (B. fragilis)을 선정하여 프라이머와 프로브 세트를 제작하였다. 해당 마커들이 선정된 종에 특이적으로 반응하는지 확인하기 위해 선정된 4종의 미생물(L. iners, L. crispatus, L. jensenii, B. fragilis)을 포함한 0.224 ng/μL 이상의 23개의 세균 genomic DNA 시료들 (Table 1)을 이용하여 동일한 PCR 조성에서 증폭시켜 실험을 수행하였다. 각각의 마커에서 C T 값이 L. iners 마커는 22.63, L. crispatus는 23.99, L. jensenii는 22.76, B. fragilis는 21.74로 검출되었다. 나머지 다른 19종의 미생물 DNA 시료들에서는 검출되지 않았으며, IPC 마커는 평균 21.98 (±0.05)의 CT로 검출되었다(data not shown). 각각의 마커는 선정된 4개의 종(L. iners, L. crispatus, L. jensenii, B. fragilis)에서만 특이적으로 증폭되었으며, 이를 통해 VB mRT-PCR의 마커들이 표적 부위에 특이성을 확인했다.

2. 한국 여성 143명의 질 내 미생물 분포 확인을 통한 마커 선정

선정된 미생물들의 한국 여성 질 내 분포 비율을 확인해 보기 위해 143명의 여성을 대상으로 실험을 수행하였다. 해당 연구를 진행하기 전에 Quantifiler Trio DNA Quantification Kit (Thermo Fisher Scientific)를 통해 여성의 질액으로부터 추출된 143명의 DNA 시료는 모두 0.1 ng/μL 이상의 여성 DNA 농도가 검출됨을 확인했다. VB mRT-PCR 키트 마커들을 통해, L. iners는 115개 시료(80.4%)에서, L. crispatus는 79개(55.2%)시료에서 그리고 L. jensenii는 56개 시료(39.2%)에서 검출되었다(Table 3). 그리고 실험에 사용된 3종의 Lactobacillus spp.를 모두 사용하였을 때, 96.5%가 검출 가능했다. 하지만 L. iners 단독으로 검출되는 경우를 제외했을 때, 선정된 미생물종 3종이 모두 검출되는 경우가 비교적 높았으므로 선정된 3종의 미생물이 한국 여성 질 상재균임에는 틀림없으나, L. jensenii의 경우, 단독으로 검출되는 시료의 개수가 5개로 매우 적을 뿐만 아니라 L. iners 또는 L. crispatus와 함께 검출되는 경우도 다른 종에 비해 낮아 다른 2종에 비해 질 분비물 예비실험 적용에 활용도가 떨어질 것으로 판단하였다. 본 연구에 사용하는 VB mRT-PCR 키트의 경우 7500 Real-Time PCR Instrument System (Thermo Fisher Scientific)을 기반으로 만들어져 멀티플렉싱 기법을 이용해 총 4개의 형광 마커가 검출이 가능하기 때문에, PCR 저해제 여부 및 원활한 증폭반응이 일어났는지 확인하기 위한 IPC 마커를 제외하고 최대 3개의 마커를 사용할 수 있어, 장내 미생물 검출을 위한 B. fragilis 외에 Lactobacillus spp. 중 2개를 선정해야 했다. 따라서 활용도가 떨어지는 것으로 판단되는 L. jensenii를 제외하고, 92.3%의 질액 식별이 가능했던 L. iners, L. crispatus, 그리고 B. fragilis를 VB mRT-PCR의 마커로 선정하였다.
Table 3.
The detected numbers of Lactobacillus species in 143 Korean women
  Detected samples (%)a
L. iners, only 43 (30.1)
L. crispatus, only 14 (9.8)
L. jensenii, only 5 (3.5)
L. iners and L. crispatus 24 (16.8)
L. iners and L. jensenii 10 (7.0)
L. crispatus and L. jensenii 3 (2.1)
L. iners, L. crispatus, and L. jensenii 38 (26.6)
Not detected 6 (4.2)
Total 143 (100)

a Detected sample: CT values below 37.

3. 분석적 성능과 민감도 연구 및 질액 검출의 기준 결정

VB mRT-PCR 키트의 질액 판별 능력이 충분한 지 확인하기 위해 표준 곡선 확인 및 민감도 실험을 진행하였다. 저, 중, 고 농도에 해당하는 103, 105, 107 copies의 DNA 샘플을 사용하여 VB mRT-PCR 키트의 standard curve를 확인하였다(Fig. 1). 해당 키트의 다중 실시간 PCR 조건은 표준곡선 결과를 기반으로 검증되었다.
Fig. 1.
Standard curves generated using a Vaginal Bacteria Multiplex Real-time PCR kit on a 7500 Real-Time PCR machine. Standard curves were analyzed using DNA samples at concentrations of 103, 105, and 107 copies/μL of each bacterium. The line at the top represents the standard curve for Lactobacillus iners, while the middle and bottom lines correspond to Lactobacillus crispatus and Bacteroides fragilis, respectively.
kjlm-45-1-14f1.gif
제작된 키트의 분석적 민감도를 확인해보고자 107 copies/μL 농도의 균주 DNA 시료들을 10배씩 희석시켜, 101-107 copies/μL 농도로 시료들을 준비한 후, 3회 반복 실험하였다(Table 4). 모든 마커에서 102-107 copies/μL 시료에 대해 표준 편차가 0.08 이하로 나타나 안정적인 결과를 얻을 수 있었다. 반면 10 copies/μL 시료의 경우, 검출이 되지 않거나 표준편차가 0.26 이상으로 다른 농도의 시료들에 비해 높게 검출되어 결과를 신뢰할 수 없었다. 또한 L. crispatus의 경우 102 copies/uL 시료의 평균 CT값이 37.26으로 비교적 높은 값을 나타냈다. 실시간 증폭 시스템을 이용할 경우 일반적으로 37 cycle 이상에서 비특이적인 결합이 발생할 수 있다고 알려져 있기 때문에[21], 분석적 민감도는 103 copies/μL 로 확인할 수 있었다
Table 4.
Threshold cycles (CT) of the VB mRT-PCR by each bacterial concentration
Concentration (copy/µL) Threshold cycles (CT)
Lactobacillus iners L. crispatus Bacteroides fragilis
107 18.81±0.02 20.50±0.06 18.80±0.02
106 22.21±0.04 23.77±0.08 22.10±0.01
105 25.67±0.07 27.19±0.05 25.52±0.03
104 28.95±0.06 30.58±0.02 28.76±0.05
103 32.43±0.04 34.17±0.08 32.18±0.03
102 35.98±0.08 37.26±0.06 35.28±0.06
10 38.95±0.36 39.38±0.39 38.14±0.26

VB mRT-PCR, Vaginal Bacteria Multiplex Real-time PCR.

4. VB mRT-PCR 키트의 법과학적 적용

국내 성폭력 사건의 다양한 인체 유래물 시료에도 활용 가능한지 확인하기 위해, 실제 성폭력 사건 및 사건 현장에서 수집된 인체유래물의 DNA 시료 잔량들을 가지고 VB mRT-PCR의 활용 가능성을 확인해 보았다(Table 5). 먼저 질 채취물로부터 분리된 130개의 DNA를 이용하여 실험한 결과, 총 122개의 시료(89.2%)에서 Lactobacillus spp.가 검출되었으며, 이 중 6개의 시료(4.6%)에서는 B. fragilis가 함께 검출되었다. 항문 및 직장 채취물로부터 분리된 DNA 시료 21개에서는 모두 B. fragilis가 검출되었으며, 이 중 18개의 시료에서는 Lactobacillus spp.가 함께 검출되었다. 타액 채취물에서 분리된 DNA 시료 20개와 혈액 채취물로부터 분리된 DNA 시료 17개에서는 모든 마커에서 검출되지 않았다.
Table 5.
Result of VB mRT-PCR kit using forensic DNA samplesa
  DNA sample type
DNA samples of vaginal swab DNA samples of anal swab DNA samples of saliva DNA samples of blood
Lactobacillus spp. 116 (89.2) 0 0 0
Lactobacillus spp. and Bacteroides fragilis 6 (4.6) 18 (85.7) 0 0
B. fragilis 0 3 (14.3) 0 0
Not detected 8 (6.2) 0 20 (100) 17 (100)
Total 130 (100) 21 (100) 20 (100) 17 (100)

VB mRT-PCR, Vaginal Bacteria Multiplex Real-time PCR.

a Detected sample: CT values below 37.

고찰

VB mRT PCR 키트는 질 내 상재균과 직장 내 상재균의 유전자를 검출하여 질액 또는 질 유래물 여부를 판단하기 위해 제작된 감식 방법이다. VB mRT PCR 키트의 마커로 선정된 L. crispatus, L. inersB. fragilisgroEL 유전자 부위를 표적으로 미생물 종 식별을 위한 프라이머와 프로브를 설계하였다. groEL 유전자는 house keeping 유전자로 분류되며, 미생물 생존에 필수적인 역할을 한다. 특히 기능적 보존 및 서열 보존이 특징으로 미생물적 조사 연구 시 유용한 마커로 활용되고 있다[22]. 해당 유전자를 이용하여 제작된 마커들은 종특이성 연구를 통해 특이도를 검증하였다.
IPC 마커와 B. fragilis 검출 마커를 포함하여 4종류의 마커 선정이 가능하기 때문에, 한국인 여성의 질 내 상재균 중 가장 높은 비율로 검출되는 2종을 선별하기 위해, 가장 높은 상재 비율로 알려진 3종(L. crispatus, L. iners, L. jensenii)의 분포를 143명의 여성을 대상으로 확인하였다. 한국 여성 143명의 질 내 미생물 분포 연구 결과(Table 3), 이전 다른 연구결과와 큰 차이가 없었다[12]. 하지만 이전 연구들과 표본시료의 수가 유사했음에도 불구하고 L. iners의 비율이 다른 연구들에 비해 높은 반면 L. crispatusL. jensenii의 비율이 낮게 검출되었다[12,14]. 본 연구는 17세에서 68세까지 다양한 연령의 한국인 여성들로 수집된 시료를 사용했기 때문에 검사 대상자의 연령, 건강 상태, 인종 그리고 주변 환경에 따라 차이에 따라 발생한 것으로 추정된다[23-26].
해당 키트는 질액의 존재 유무 또는 출처 불명 체액의 근원을 확인하기 위해 제작된 정성평가 키트이다. 그렇기 때문에, 유무를 평가할 수 있는 명확한 C T threshold 기준이 필요하여, 해당 키트의 성능평가를 위해 표준곡선 확인 및 민감도 연구가 진행되었다. 민감도 연구 결과에서 각 마커들의 분석적 민감도는 103 copies/μL로 확인되었다(Table 3). DNA copy 수에 따른 아보가드로 수를 이용한 DNA 양을 계산해보면[27-29], 각 DNA 시료가 103 copies일 경우 L. crispatus는 약 0.25 pg, L. iners는 약 0.15 pg 그리고 B. fragilis는 약 0.57 pg의 극소량으로 확인할 수 있었다. 이를 토대로 새롭게 제작된 VB mRT-PCR이 사건 현장의 시료를 검출할 만큼 충분한 분석적 민감도를 지닌다는 점을 확인할 수 있었다. L. inersL. crispatus 마커들 중 한 개라도 C T 값이 37 이하로 분석되고, B. fragilis 마커가 증폭되지 않을 경우, 질 분비물 또는 질 유래물로 판별할 수 있을 것으로 판단되지만, 인체 내에서 발생할 수 있는 교차 오염 가능성을 고려한 판단이 필요할 것이다.
성폭력 사건의 인체 유래물 시료에 활용 가능성 여부를 확인해보고자 진행된 사건 현장에서 수집된 인체유래물의 DNA 시료로 연구를 진행했다. 질 채취물로부터 분리된 130개의 DNA 시료들 중 6개의 시료에서 Lactobacillus spp.와 B. fragilis가 함께 검출되었다(Table 5). 검출된 6개의 시료 중 5개의 시료는 사건 중 항문성교 행위가 포함하여 발생한 것으로 확인되어, 본 실험에 선정된 3가지 미생물이 유효성을 확인할 수 있었으며, 나머지 1개의 시료는 여성의 외음부에서 채취된 것으로서, 일상 생활 중 항문의 B. fragilis가 외음부 부위로 전이되어 검출된 것으로 추정된다. 항문 및 직장 채취물로부터 분리된 DNA 시료에서는 21개 모두에서 B. fragilis 가 검출되었으며, 이 중 18개의 시료에서는 Lactobacillus spp.가 함께 검출되었다. L. inersL. crispatus는 질 내에서 상재할 뿐만 아니라 장 내에서도 상재하기 때문에[16], 직장 채취물에서 검출이 가능할 것으로 판단되지만, 성 관계 후 질 분비물이 항문 또는 직장으로 전이될 가능성 또한 배제할 수 없다. 따라서 증거물 채취 시보다 많은 정보를 획득한다면, 분석 결과를 해석하는데 도움이 될 것으로 판단된다. 해당 결과를 통해, VB mRT-PCR 키트를 사용한 질 분비물 예비시험 활용 가능성을 확인할 수 있었다. 해당 현장 시료 연구에서 사용된 시료들은 성폭력 사건에 연관된 인체 유래물로부터 추출된 DNA 시료들이 사용되었기 때문에, 상대적으로 온전한 상태의 검체들로 연구가 진행되었다. 그러므로, 실제 성범죄 사건에서 수집된 속옷으로부터 수집된 swab 또는 사체의 질액과 같이, 다양한 환경에서 채취된 검체들에 대한 유효성 연구가 추가적으로 진행된다면 해당 연구 기법을 보다 효율적으로 활용할 수 있을 것으로 사료된다.
해당 연구는 질 내 상재균을 이용하여 실시간 PCR 기법을 기반한 질액 식별 키트의 활용 가능성에 대해 제시하고 있다. 이전 연구에서도 mRNA나 상재 미생물을 마커로 이용한 체액 식별키트들이 연구되어 왔다[30-32]. VB mRT-PCR 키트는 질 내 상재균 마커뿐 만 아니라 직장 및 항문 유래 상재균 마커가 포함되어, 한번의 PCR 반응으로 더욱 정확한 질액 식별이 가능하다는 차별성을 가지고 있다. 또한, 현장 시료로부터 추출된 DNA 시료를 별도의 전처리 없이 VB mRT-PCR에 사용할 수 있어 실험 과정을 단순화하고 시간을 절약할 수 있다[7]. 반면, 건강한 여성의 질 내 상재균의 분포는 인종과 연령 그리고 주변 환경에 따라 변하는 것으로 알려져 있어[25], 질 내 상재균 분포가 국가마다 조금씩 다른 경향성을 나타낸다[26]. 해당 연구에서는 한국인 여성의 질 유래물을 대상으로 연구가 진행되었기 때문에, 다양한 국가의 여성들의 시료들을 대상으로 유효성 검토를 추가적으로 진행해볼 필요가 있을 것으로 판단된다.
VB mRT-PCR 키트는 표적 균주들의 동정에 사용될 수 있을 뿐만 아니라, 질 유래물 선별 기능을 통해 지금까지 확인이 어려웠던 성추행 등 성범죄 여부에 대한 확인 업무를 보다 빠르고 효율적으로 수행할 수 있을 것으로 기대된다.

Notes

Conflicts of Interest

Hyun Kyu Yoon is employee of AttoPlex Corporation. All remaining authors have declared no conflicts of interest.

Acknowledgments

This work was supported by National Forensic Service (NFS2020DNA01), Ministry of the Interior and Safety, Republic of Korea.

References

1. Costello EK, Lauber CL, Hamady M. Bacterial community variation in human body habitats across space and time. Science 2009;326:1694-7.
crossref pmid pmc
2. Lehman DC. Forensic microbiology. Clin Lab Sci 2012;25:114-9.
crossref pmid
3. Pang BC, Cheung BK. Applicability of two commercially available kits for forensic identification of saliva stains. J Forensic Sci 2008;53:1117-22.
crossref pmid
4. Juusola J, Ballantyne J. Messenger RNA profiling: a prototype method to supplant conventional methods for body fluid identification. Forensic Sci Int 2003;135:85-96.
crossref pmid
5. An JH, Shin KJ, Yang WI. Body fluid identification in forensics. BMB Rep 2012;45:545-53.
crossref pmid pdf
6. Lee HY, Park MJ, Choi A. Potential forensic application of DNA methylation profiling to body fluid identification. Int J Legal Med 2012;126:55-62.
crossref pmid pdf
7. Jung JY, Yoon HK, An S. Rapid oral bacteria detection based on real-time PCR for the forensic identification of saliva. Sci Rep 2018;8:10852.
crossref pmid pmc pdf
8. Lee HY, Jung SE, Oh YN. Epigenetic age signatures in the forensically relevant body fluid of semen: a preliminary study. Forensic Sci Int Genet 2015;19:28-34.
crossref pmid
9. Mackay IM, Arden KE, Nitsche A. Real-time PCR in virology. Nucleic Acids Res 2002;30:1292-305.
crossref pmid pmc pdf
10. Hausmann R, Schellmann B. Forensic value of the Lugol's staining method: further studies on glycogenated epithelium in the male urinary tract. Int J Legal Med 1994;107:147-51.
crossref pmid pdf
11. Rothwell TJ, Harvey KJ. The limitations of the Lugol's iodine staining technique for the identification of vaginal epithelial cells. J Forensic Sci Soc 1978;18:181-4.
crossref pmid
12. Oh CR, Cho HB. Rapid detection of Lactobacillus genus inhabiting in vagina of 20's healthy women using multiplex PCR. Korean J Microbiol 2012;48:309-13.
crossref
13. Witkin SS, Linhares IM, Giraldo P. Bacterial flora of the female genital tract: function and immune regulation. Best Pract Res Clin Obstet Gynaecol 2007;21:347-54.
crossref pmid
14. Kim JH, Yoo SM, Sohn YH. Predominant Lactobacillus species types of vaginal microbiota in pregnant Korean women: quantification of the five Lactobacillus species and two anaerobes. J Matern Fetal Neonatal Med 2017;30:2329-33.
crossref pmid
15. You YA, Kwon EJ, Choi SJ. Vaginal microbiome profiles of pregnant women in Korea using a 16S metagenomics approach. Am J Reprod Immunol 2019;82:e13124.
crossref
16. El Aila NA, Tency I, Saerens B. Strong correspondence in bacterial loads between the vagina and rectum of pregnant women. Res Microbiol 2011;162:506-13.
crossref pmid
17. Wexler HM. Bacteroides: the good, the bad, and the nitty-gritty. Clin Microbiol Rev 2007;20:593-621.
crossref pmid pmc
18. Zitomersky NL, Coyne MJ, Comstock LE. Longitudinal analysis of the prevalence, maintenance, and IgA response to species of the order Bacteroidales in the human gut. Infect Immun 2011;79:2012-20.
crossref pmid pmc
19. Qiagen. QIAamp DNA micro handbook. 2nd ed.[Internet].Hilden: Qiagen; 2010. [cited 2020 Dec 28]. Available from:. https://www.qiagen.com/˜/media/4D8DF38311F64606847546D1A40F0985.ashx.

20. Thermo Fisher Scientific. Quantifiler HP and Trio DNA quantification kits: user guide [Internet]. Waltham, MA: Thermo Fisher Scientific; 2018. [cited 2021 Jan 29]. Available from:. https://assets.thermofisher.com/TFS-Assets/LSG/manuals/4485354.pdf.

21. Bustin SA, Benes V, Garson JA. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 2009;55:611-22.
crossref pmid pdf
22. Ventura M, Canchaya C, Zink R. Characterization of the groEL and groES loci in Bifidobacterium breve UCC 2003: genetic, transcriptional, and phylogenetic analyses. Appl Environ Microbiol 2004;70:6197-209.
crossref pmid pmc
23. Martinez-Pena MD, Castro-Escarpulli G, Aguilera-Arreola MG. Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study. BMC Infect Dis 2013;13:189.
pmid pmc
24. Tachedjian G, Aldunate M, Bradshaw CS. The role of lactic acid production by probiotic Lactobacillus species in vaginal health. Res Microbiol 2017;168:782-92.
crossref pmid
25. Redondo-Lopez V, Cook RL, Sobel JD. Emerging role of lactobacilli in the control and maintenance of the vaginal bacterial microflora. Rev Infect Dis 1990;12:856-72.
crossref pmid pdf
26. Pavlova SI, Kilic AO, Kilic SS. Genetic diversity of vaginal lactobacilli from women in different countries based on 16S rRNA gene sequences. J Appl Microbiol 2002;92:451-9.
crossref pmid
27. Lee C, Kim J, Shin SG. Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli . J Biotechnol 2006;123:273-80.
crossref pmid
28. Whelan JA, Russell NB, Whelan MA. A method for the absolute quantification of cDNA using real-time PCR. J Immunol Methods 2003;278:261-9.
crossref pmid
29. Yun JJ, Heisler LE, Hwang II. Genomic DNA functions as a universal external standard in quantitative real-time PCR. Nucleic Acids Res 2006;34:e85.
crossref pmid pmc pdf
30. De Vittori E, Giampaoli S, Barni F. Improvement and automation of a real-time PCR assay for vaginal fluids. Forensic Sci Int 2016;262:179-82.
crossref pmid
31. Fleming RI, Harbison S. The use of bacteria for the identification of vaginal secretions. Forensic Sci Int Genet 2010;4:311-5.
crossref pmid
32. Giampaoli S, Berti A, Valeriani F. Molecular identification of vaginal fluid by microbial signature. Forensic Sci Int Genet 2012;6:559-64.
crossref pmid


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Institute of Forensic Medicine and Department of Forensic Medicine, Seoul National University College of Medicine
103 Daehak-ro, Jongno-gu, Seoul 03080, Korea
Tel: +82-2-740-8360    Fax: +82-2-902-8340    E-mail: yoosh@snu.ac.kr                

Copyright © 2021 by The Korean Society for Legal Medicine. All rights reserved.

Developed in M2PI

Close layer
prev next